Records using themekt "Global Change Master Science Directory"

Results are color-coded by center: PCMSC SPCMSC WHCMSC

EAARL Coastal Topography-Louisiana, Mississippi and Alabama, March 2006: First Return

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography-Louisiana, Mississippi and Alabama, March 2006: First Return

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography-Louisiana, Mississippi and Alabama, March 2006: Last Return

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography-Louisiana, Mississippi and Alabama, March 2006: Last Return

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography--Louisiana, Mississippi and Alabama September 2006: First Return

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography--Louisiana, Mississippi and Alabama September 2006: First Return

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography--Louisiana, Mississippi and Alabama September 2006: Last Return

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography--Louisiana, Mississippi and Alabama September 2006: Last Return

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Port St. Lucie to Marquesas Key, Florida-100 Years From 2001 Based on Historical Rates of Mean Elevation Change

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation along the Florida Reef Tract, Florida (FL). USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of elevation change were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean elevation change for each habitat type was applied to a digital elevation model (DEM) extending from Port St. Lucie to Marquesas Key, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) U.S. Coastal Relief Model coastal DEM (NOAA, 2001) to project future seafloor elevation (from 2001) along the Florida Reef Tract. Grid resolution for the DEM is 3-arc seconds (approximately 90 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Port St. Lucie to Marquesas Key, Florida-100 Years From 2001 Based on Historical Rates of Mean Erosion

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation along the Florida Reef Tract, Florida (FL). USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of erosion were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean erosion for each habitat type was applied to a digital elevation model (DEM) extending from Port St. Lucie to Marquesas Key, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) U.S. Coastal Relief Model coastal DEM (NOAA, 2001) to project future seafloor elevation (from 2001) along the Florida Reef Tract. Grid resolution for the DEM is 3-arc seconds (approximately 90 meters(m)).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Big Pine Key to Marquesas Key, Florida-100 Years From 2011 Based on Historical Rates of Mean Elevation Change

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation for several sites along the Florida Reef Tract, Florida (FL) including the shallow seafloor along Key West, FL. USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of elevation change were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean elevation change for each habitat type was applied to a digital elevation model (DEM) extending from Big Pine Key to Marquesas Key, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) Key West coastal DEM (NOAA, 2011) to project future seafloor elevation (from 2011) along the Key West section of the Florida Reef Tract. Grid resolution for the DEM is 1/3 arc second (approximately 10 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Big Pine Key to Marquesas Key, Florida-100 Years From 2011 Based on Historical Rates of Mean Erosion

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation for several sites along the Florida Reef Tract, Florida (FL) including the shallow seafloor along Key West, FL. USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of erosion were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean erosion for each habitat type was applied to a digital elevation model (DEM) extending from Big Pine Key to Marquesas Key, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) Key West coastal DEM (NOAA, 2011) to project future seafloor elevation (from 2011) along the Key West section of the Florida Reef Tract. Grid resolution for the DEM is 1/3 arc-second (approximately 10 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Deerfield Beach to Homestead, Florida—100 Years From 2014 Based on Historical Rates of Mean Elevation Change

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation for several sites along the Florida Reef Tract, Florida (FL) including the shallow seafloor along the coast of Miami, FL. USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of elevation change were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean elevation change for each habitat type was applied to a digital elevation model (DEM) extending from Deerfield Beach to Homestead, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) Miami coastal DEM (NOAA, 2015) to project future seafloor elevation (from 2014) along the Miami section of the Florida Reef Tract. Grid resolution for the DEM is 1/3 arc second (approximately 10 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Deerfield Beach to Homestead, Florida—100 Years From 2014 Based on Historical Rates of Mean Erosion

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation for several sites along the Florida Reef Tract, Florida (FL) including the shallow seafloor along the coast of Miami, FL. USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of erosion were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean erosion for each habitat type was applied to a digital elevation model (DEM) extending from Deerfield Beach to Homestead, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) Miami coastal DEM (NOAA, 2015) to project future seafloor elevation (from 2014) along the Miami section of the Florida Reef Tract. Grid resolution for the DEM is 1/3 arc second (approximately 10 meters).

Info
Seafloor elevation change from the 1930s to 2016 along the Florida Reef Tract, USA

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify bathymetric changes along the Florida Reef Tract (FRT) from Miami to Key West within a 982.4 square-kilometer area. USGS staff calculated changes in seafloor elevation from the 1930’s to 2016 using digitized historical hydrographic surveys (H-sheets) acquired by the U.S. Coast and Geodetic Survey (USC&GS) in the 1930’s and light detection and ranging (lidar)-derived digital elevation models (DEMs) acquired by the National Oceanic and Atmospheric Administration (NOAA) in 2016 and 2017. Most of the elevation data from the 2016/2017 time period were collected during 2016, so as an abbreviated naming convention, we refer to this time frame as 2016. An elevation change analysis between the 1930’s and 2016 data was performed to quantify and map impacts to seafloor elevation and to determine elevation and volume change statistics for 14 habitat types found within the study area along the FRT. Data were collected under Florida Keys National Marine Sanctuary permit FKNMS-2016-068.

Info
Seafloor elevation change from 2002 to 2016 in the Upper Florida Keys

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify bathymetric changes in the Upper Florida Keys (UFK) from Triumph Reef to Pickles Reef within a 242.4 square-kilometer area. USGS staff calculated changes in seafloor elevation from 2002 to 2016 using light detection and ranging (lidar)-derived data acquired by the USGS in 2001 and 2002 and lidar-derived data acquired by the National Oceanic and Atmospheric Administration (NOAA) in 2016 and 2017. Most of the elevation data from these two time periods was collected during 2002 and 2016. As an abbreviated naming convention, we refer to this study time period and dataset as 2002-2016. An elevation change analysis between the 2002 and 2016 lidar data was performed to quantify and map impacts to seafloor elevation and to determine elevation and volume change statistics for 13 habitat types found in the UFK. This elevation change study was conducted under Florida Keys National Marine Sanctuary permit FKNMS-2016-068.

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Port St. Lucie to Marquesas Key, Florida-25 Years From 2001 Based on Historical Rates of Mean Elevation Change

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation along the Florida Reef Tract, Florida (FL). USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of elevation change were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean elevation change for each habitat type was applied to a digital elevation model (DEM) extending from Port St. Lucie to Marquesas Key, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) U.S. Coastal Relief Model coastal DEM (NOAA, 2001) to project future seafloor elevation (from 2001) along the Florida Reef Tract. Grid resolution for the DEM is 3-arc seconds (approximately 90 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Port St. Lucie to Marquesas Key, Florida-25 Years From 2001 Based on Historical Rates of Mean Erosion

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation along the Florida Reef Tract, Florida (FL). USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of erosion were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean erosion for each habitat type was applied to a digital elevation model (DEM) extending from Port St. Lucie to Marquesas Key, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) U.S. Coastal Relief Model coastal DEM (NOAA, 2001) to project future seafloor elevation (from 2001) along the Florida Reef Tract. Grid resolution for the DEM is 3-arc seconds (approximately 90 meters (m)).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Big Pine Key to Marquesas Key, Florida-25 Years From 2011 Based on Historical Rates of Mean Elevation Change

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation for several sites along the Florida Reef Tract, Florida (FL) including the shallow seafloor along Key West, FL. USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of elevation change were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean elevation change for each habitat type was applied to a digital elevation model (DEM) extending from Big Pine Key to Marquesas Key, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) Key West coastal DEM (NOAA, 2011) to project future seafloor elevation (from 2011) along the Key West section of the Florida Reef Tract. Grid resolution for the DEM is 1/3 arc second (approximately 10 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Big Pine Key to Marquesas Key, Florida-25 Years From 2011 Based on Historical Rates of Mean Erosion

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation for several sites along the Florida Reef Tract, Florida (FL) including the shallow seafloor along Key West, FL. USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of erosion were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean erosion for each habitat type was applied to a digital elevation model (DEM) extending from Big Pine Key to Marquesas Key, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) Key West coastal DEM (NOAA, 2011) to project future seafloor elevation (from 2011) along the Key West section of the Florida Reef Tract. Grid resolution for the DEM is 1/3 arc-second (approximately 10 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Deerfield Beach to Homestead, Florida-25 Years From 2014 Based on Historical Rates of Mean Elevation Change

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation for several sites along the Florida Reef Tract, Florida (FL) including the shallow seafloor along the coast of Miami, FL. USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of elevation change were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean elevation change for each habitat type was applied to a digital elevation model (DEM) extending from Deerfield Beach to Homestead, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) Miami coastal DEM (NOAA, 2015) to project future seafloor elevation (from 2014) along the Miami section of the Florida Reef Tract. Grid resolution for the DEM is 1/3 arc second (approximately 10 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Deerfield Beach to Homestead, Florida—25 Years From 2014 Based on Historical Rates of Mean Erosion

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation for several sites along the Florida Reef Tract, Florida (FL) including the shallow seafloor along the coast of Miami, FL. USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of erosion were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean erosion for each habitat type was applied to a digital elevation model (DEM) extending from Deerfield Beach to Homestead, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) Miami coastal DEM (NOAA, 2015) to project future seafloor elevation (from 2014) along the Miami section of the Florida Reef Tract. Grid resolution for the DEM is 1/3 arc second (approximately 10 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Port St. Lucie to Marquesas Key, Florida-50 Years From 2001 Based on Historical Rates of Mean Elevation Change

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation along the Florida Reef Tract, Florida (FL). USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of elevation change were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean elevation change for each habitat type was applied to a digital elevation model (DEM) extending from Port St. Lucie to Marquesas Key, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) U.S. Coastal Relief Model coastal DEM (NOAA, 2001) to project future seafloor elevation (from 2001) along the Florida Reef Tract. Grid resolution for the DEM is 3-arc seconds (approximately 90 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Port St. Lucie to Marquesas Key, Florida-50 Years From 2001 Based on Historical Rates of Mean Erosion

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation along the Florida Reef Tract, Florida (FL). USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of erosion were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean erosion for each habitat type was applied to a digital elevation model (DEM) extending from Port St. Lucie to Marquesas Key, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) U.S. Coastal Relief Model coastal DEM (NOAA, 2001) to project future seafloor elevation (from 2001) along the Florida Reef Tract. Grid resolution for the DEM is 3-arc seconds (approximately 90 meters (m)).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Big Pine Key to Marquesas Key, Florida-50 Years From 2011 Based on Historical Rates of Mean Elevation Change

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation for several sites along the Florida Reef Tract, Florida (FL) including the shallow seafloor along Key West, FL. USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of elevation change were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean elevation change for each habitat type was applied to a digital elevation model (DEM) extending from Big Pine Key to Marquesas Key, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) Key West coastal DEM (NOAA, 2011) to project future seafloor elevation (from 2011) along the Key West section of the Florida Reef Tract. Grid resolution for the DEM is 1/3 arc second (approximately 10 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Big Pine Key to Marquesas Key, Florida-50 Years From 2011 Based on Historical Rates of Mean Erosion

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation for several sites along the Florida Reef Tract, Florida (FL) including the shallow seafloor along Key West, FL. USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of erosion were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean erosion for each habitat type was applied to a digital elevation model (DEM) extending from Big Pine Key to Marquesas Key, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) Key West coastal DEM (NOAA, 2011) to project future seafloor elevation (from 2011) along the Key West section of the Florida Reef Tract. Grid resolution for the DEM is 1/3 arc-second (approximately 10 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Deerfield Beach to Homestead, Florida—50 Years From 2014 Based on Historical Rates of Mean Elevation Change

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation for several sites along the Florida Reef Tract, Florida (FL) including the shallow seafloor along the coast of Miami, FL. USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of elevation change were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean elevation change for each habitat type was applied to a digital elevation model (DEM) extending from Deerfield Beach to Homestead, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) Miami coastal DEM (NOAA, 2015) to project future seafloor elevation (from 2014) along the Miami section of the Florida Reef Tract. Grid resolution for the DEM is 1/3 arc second (approximately 10 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Deerfield Beach to Homestead, Florida—50 Years From 2014 Based on Historical Rates of Mean Erosion

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation for several sites along the Florida Reef Tract, Florida (FL) including the shallow seafloor along the coast of Miami, FL. USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of erosion were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean erosion for each habitat type was applied to a digital elevation model (DEM) extending from Deerfield Beach to Homestead, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) Miami coastal DEM (NOAA, 2015) to project future seafloor elevation (from 2014) along the Miami section of the Florida Reef Tract. Grid resolution for the DEM is 1/3 arc second (approximately 10 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Port St. Lucie to Marquesas Key, Florida-75 Years From 2001 Based on Historical Rates of Mean Elevation Change

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation along the Florida Reef Tract, Florida (FL). USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of elevation change were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean elevation change for each habitat type was applied to a digital elevation model (DEM) extending from Port St. Lucie to Marquesas Key, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) U.S. Coastal Relief Model coastal DEM (NOAA, 2001) to project future seafloor elevation (from 2001) along the Florida Reef Tract. Grid resolution for the DEM is 3-arc seconds (approximately 90 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Port St. Lucie to Marquesas Key, Florida-75 Years From 2001 Based on Historical Rates of Mean Erosion

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation along the Florida Reef Tract, Florida (FL). USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of erosion were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean erosion for each habitat type was applied to a digital elevation model (DEM) extending from Port St. Lucie to Marquesas Key, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) U.S. Coastal Relief Model coastal DEM (NOAA, 2001) to project future seafloor elevation (from 2001) along the Florida Reef Tract. Grid resolution for the DEM is 3-arc seconds (approximately 90 meters (m)).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Big Pine Key to Marquesas Key, Florida-75 Years From 2011 Based on Historical Rates of Mean Elevation Change

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation for several sites along the Florida Reef Tract, Florida (FL) including the shallow seafloor along Key West, FL. USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of elevation change were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean elevation change for each habitat type was applied to a digital elevation model (DEM) extending from Big Pine Key to Marquesas Key, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) Key West coastal DEM (NOAA, 2011) to project future seafloor elevation (from 2011) along the Key West section of the Florida Reef Tract. Grid resolution for the DEM is 1/3 arc second (approximately 10 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Big Pine Key to Marquesas Key, Florida-75 Years From 2011 Based on Historical Rates of Mean Erosion

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation for several sites along the Florida Reef Tract, Florida (FL) including the shallow seafloor along Key West, FL. USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of erosion were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean erosion for each habitat type was applied to a digital elevation model (DEM) extending from Big Pine Key to Marquesas Key, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) Key West coastal DEM (NOAA, 2011) to project future seafloor elevation (from 2011) along the Key West section of the Florida Reef Tract. Grid resolution for the DEM is 1/3 arc-second (approximately 10 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Deerfield Beach to Homestead, Florida—75 Years From 2014 Based on Historical Rates of Mean Elevation Change

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation for several sites along the Florida Reef Tract, Florida (FL) including the shallow seafloor along the coast of Miami, FL. USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of elevation change were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean elevation change for each habitat type was applied to a digital elevation model (DEM) extending from Deerfield Beach to Homestead, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) Miami coastal DEM (NOAA, 2015) to project future seafloor elevation (from 2014) along the Miami section of the Florida Reef Tract. Grid resolution for the DEM is 1/3 arc second (approximately 10 meters).

Info
Projected Seafloor Elevation Along the Florida Reef Tract From Deerfield Beach to Homestead, Florida—75 Years From 2014 Based on Historical Rates of Mean Erosion

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by projecting future regional-scale changes in seafloor elevation for several sites along the Florida Reef Tract, Florida (FL) including the shallow seafloor along the coast of Miami, FL. USGS staff used historical bathymetric point data from the 1930's (National Oceanic and Atmospheric Administration (NOAA) Office of Coast Survey, see Yates and others, 2017) and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate historical seafloor elevation changes in the Upper Florida Keys (UFK) (Yates and others, 2017). Using those changes in seafloor elevation, annual rates of erosion were calculated for 13 habitat types found in the UFK reef tract. The annual rate of mean erosion for each habitat type was applied to a digital elevation model (DEM) extending from Deerfield Beach to Homestead, FL that was modified from the NOAA National Centers for Environmental Information (NCEI) Miami coastal DEM (NOAA, 2015) to project future seafloor elevation (from 2014) along the Miami section of the Florida Reef Tract. Grid resolution for the DEM is 1/3 arc second (approximately 10 meters).

Info
EAARL Coastal Topography--Assateague Island National Seashore, Maryland and Virginia, 2002: Bare Earth

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements acquired cooperatively by the U.S. Geological Survey (USGS) and the National Park Service (NPS). Elevation measurements were collected over Assateague Island National Seashore using the first-generation National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography--Assateague Island National Seashore, Maryland and Virginia, 2002: First Surface

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements acquired cooperatively by the U.S. Geological Survey (USGS) and the National Park Service (NPS). Elevation measurements were collected over Assateague Island National Seashore using the first-generation National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
Cold-water coral microbiomes (Astrangia poculata) from Narragansett Bay: sequence data

The files provided in this data release are the DNA sequence files referenced in Goldsmith and others (2019), which represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of Astrangia poculata microbiomes completed using Sanger dideoxy sequencing. The coral samples were collected from Narragansett Bay at Fort Wetherill State Park, Jamestown, Rhode Island in 2015 and 2016 (Sharp and others, 2017). Sequences were obtained by first extracting DNA from a fragment of each A. poculata sample comprising mucus, tissue, and skeleton. Bacterial DNA was amplified from all samples by polymerase chain reaction (PCR), using primers 8F (5’–AGA GTT TGA TCC TGG CTC AG) and 1492R (5’–GGT TAC CTT GTT ACG ACT T) to target the 16S rDNA gene in bacteria. Archaeal DNA from two of the samples (FW1B8 and FW1W8) was amplified using primers 21F (5'–TTC CGG TTG ATC CYG CCG GA) and 958R (5'–YCC GGC GTT GAM TCC AAT T) to target the 16S rDNA gene from archaea. All amplicons were visualized on an agarose gel, extracted from the gel, quantitated, cloned into a vector, and used to transform competent cells. Inserts in positive transformants were sequenced by the Clemson University Genomics Computational Laboratory (Clemson, SC). The sequences were processed by trimming vectors and ends, removing sequences less than 50 base pairs (bp), checking for chimeras, classifying taxonomy, and removing unclassified, chloroplast, and mitochondrial sequences. After processing, 806 bacterial operational taxonomic units (OTUs) and 18 archaeal OTUs remained. Sequences representing each OTU have been deposited in the National Center for Biotechnology Information’s (NCBI) GenBank archive, and have been assigned accession numbers MK175495 through MK176300 (bacterial sequences) and MH915525 through MH915542 (archaeal sequences). Minimum information about a marker gene (MIMARKS) compliant metadata files are also included in the data download files. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: [email protected].

Info
EAARL Coastal Topography--Dauphin Island, Alabama, 2010: Bare Earth

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over Dauphin Island, post-Tropical Storm Bonnie (July 2010 tropical storm), using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography--Dauphin Island, Alabama, 2010: First Surface

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over Dauphin Island, post-Tropical Storm Bonnie (July 2010 tropical storm), using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
Lidar-Derived Bare-Earth XYZ for EAARL Coastal Topography—Cape Hatteras, North Carolina, Post-Hurricane Isabel, 2003

ASCII XYZ data for Cape Hatteras, North Carolina, were produced from remotely sensed, geographically referenced elevation measurements collected post-Hurricane Isabel on September 21, 2003 by the U.S. Geological Survey, in cooperation with the National Aeronautics and Space Administration (NASA). Elevation measurements were collected over the area using the first-generation Experimental Advanced Airborne Research Lidar (EAARL-A), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
Lidar-Derived Bare-Earth XYZ for EAARL Coastal Topography—Cape Hatteras, North Carolina, Pre-Hurricane Isabel, 2003

ASCII XYZ data for Cape Hatteras, North Carolina, were produced from remotely sensed, geographically referenced elevation measurements collected pre-Hurricane Isabel on September 16, 2003 by the U.S. Geological Survey, in cooperation with the National Aeronautics and Space Administration (NASA). Elevation measurements were collected over the area using the first-generation Experimental Advanced Airborne Research Lidar (EAARL-A), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography—Chandeleur Islands, Louisiana, 4-5 September 2010: Seamless (Bare Earth and Submerged)

ASCII XYZ point-cloud data for the Chandeleur Islands in Louisiana were produced from remotely sensed, geographically referenced elevation measurements collected on September 4 and 5, 2010 by the U.S. Geological Survey. Elevation measurements were collected over the area using the first-generation Experimental Advanced Airborne Research Lidar (EAARL-A), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography—Chandeleur Islands, Louisiana, 12-13 February 2011: Seamless (Bare Earth and Submerged)

ASCII XYZ point-cloud data for the Chandeleur Islands in Louisiana were produced from remotely sensed, geographically referenced elevation measurements collected on February 12 and 13, 2011 by the U.S. Geological Survey. Elevation measurements were collected over the area using the first-generation Experimental Advanced Airborne Research Lidar (EAARL-A), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
Lidar-Derived Classified Point-Cloud for Coastal Topography—Chandeleur Islands, Louisiana, 23-25 June 2016

Binary point-cloud data were produced for the Chandeleur Islands, Louisiana, from remotely sensed, geographically referenced elevation measurements collected by Leading Edge Geomatics (LEG) using a Leica Chiroptera II Bathymetric and Topographic Sensor. Dewberry reports that the nominal pulse spacing for this project was 1 point every 0.7 meters. Dewberry used proprietary procedures to classify the LAS according to project specifications: 0-Never Classified, 1-Unclassified, 2-Ground (includes model key point bit for points identified as Model Key Point), 7-Low Noise, 17-Bridges, 18-High Noise, 40-Bathymetric point or submerged topography (includes model key point bit for points identified as Model Key Point), 41-Water Surface, and 42-Derived water surface.

Info
Lidar-Derived Seamless Digital Elevation Model (DEM) Mosaic for Coastal Topography—Chandeleur Islands, Louisiana, 23-25 June 2016

A digital elevation model (DEM) mosaic was produced for the Chandeleur Islands, Louisiana, from remotely sensed, geographically referenced elevation measurements collected by Leading Edge Geomatics (LEG) using a Leica Chiroptera II Bathymetric and Topographic Sensor. Dewberry reports that the nominal pulse spacing for this project was 1 point every 0.7 meters. Dewberry used proprietary procedures to classify the LAS according to project specifications: 0-Never Classified, 1-Unclassified, 2-Ground (includes model key point bit for points identified as Model Key Point), 7-Low Noise, 17-Bridges, 18-High Noise, 40-Bathymetric point or submerged topography (includes model key point bit for points identified as Model Key Point), 41-Water Surface, and 42-Derived water surface.

Info
Photomicrograph Images of Sediment Samples Collected at Crocker Reef, Florida, 2013-2014

Understanding the processes that govern whether a coral reef is accreting (growing) or dissolving are fundamental to questions of reef health and resiliency. A total of 52 surficial sediment samples were collected within a 1-km x 1-km area around Crocker Reef in the Florida Keys, USA, between 2013 and 2014. Samples 1-35 were collected in July 2013 and samples 36-52 were collected in July 2014. The samples were processed using conventional, published techniques (see process step section) to yield grain size and mineralogical data. The dataset, CRKR2013-2014_SEDIMENT_Images.zip contains photomicrograph images that correspond to each sediment sample. These images also include additional, survey-specific EXchangable Image File format (EXIF) header information.

Info
Grainsize and Mineralogy Data of Sediments Samples Collected at Crocker Reef, Florida, 2013-2014

Understanding the processes that govern whether a coral reef is accreting (growing) or dissolving are fundamental to questions of reef health and resiliency. A total of 52 surficial sediment samples were collected within a 1-km x 1-km area around Crocker Reef in the Florida Keys, USA, between 2013 and 2014. Samples 1-35 were collected in July 2013 and samples 36-52 were collected in July 2014. The samples were processed using conventional, published techniques (see process step 2) to yield grain size and mineralogical data. The dataset, CRKR2013-2014_SEDIMENT_Mineralogy.zip contains a spreadsheet with mineralogical data for each sample. The dataset, CRKR2013-2014_SEDIMENT_GrainSize.zip contains a spreadsheet with grain size data for each sample.

Info
Shallow ATRIS (sATRIS) Images Crocker Reef, Florida, 2014

Underwater digital images, single-beam bathymetry, and global positioning system (GPS) data were collected June 24-25, 2014, within a 1-kilkometer (km) x 1-km area around Crocker Reef in the Florida Keys, USA. A total of 91,206 images of the seafloor and water column were collected along pre-defined transect lines and organized into three sets: track1, track2, and track3. This data release contains a subset of those images (25,485 images), all of which were used for benthic habitat classification, and contain GPS data. The data were collected using the U.S. Geological Survey (USGS) shallow Along-Track Reef-Imaging System (sATRIS), a boat-based, pole-mounted sensor package for mapping shallow-water benthic environments. Two other implementations exist, a towed system called Deep ATRIS and a profiling system called Drift ATRIS. All three ATRIS implementations incorporate a digital still camera and an acoustic depth sounder.

Info
Distribution of Benthic Habitats at Crocker Reef, Florida, 2014

The distribution of benthic habitats for a 1-kilometer (km) x 1-km area around Crocker Reef in the Florida Keys, USA, is based upon underwater digital images of the seafloor collected on June 24 and 25, 2014 (Zawada and others, 2016). The imagery was collected using the U.S. Geological Survey (USGS) shallow Along-Track Reef-Imaging System (sATRIS), a boat-based, pole-mounted sensor package for mapping shallow-water benthic environments. The polygons contained in the shapefile included in this data release, Habitat.shp, represent the four general habitat types found at Crocker Reef: hardbottom, rubble, sand, and seagrass.

Info
Cold-water coral microbiomes (Lophelia pertusa) from Gulf of Mexico and Atlantic Ocean: raw data

The files in this data release are the raw deoxyribonucleic acid (DNA) sequence files referenced in the submitted journal article by Christina A. Kellogg, Dawn B. Goldsmith and Michael A. Gray entitled "Biogeographic comparison of Lophelia-associated bacterial communities in the western Atlantic reveals conserved core microbiome". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the coral’s microbiomes completed using Roche 454 pyrosequencing with Titanium series reagents. Samples from the Gulf of Mexico were collected in 2009 and 2010. Samples from the Atlantic Ocean were collected in 2009. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA305617. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Lophelia metadata", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; email: [email protected].

Info
Cold-water coral microbiomes (Primnoa spp.) from Gulf of Alaska, Baltimore Canyon, and Norfolk Canyon: raw data

The files in this data release are the raw DNA sequence files referenced in the journal article by Goldsmith and others (2018) entitled "Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the corals’ microbiomes (Primnoa spp.) completed using Roche 454 pyrosequencing with Titanium series reagents. The 16S rRNA gene was amplified using primers for the V4-V5 region (fwd: 5? AYTGGGYDTAAAGNG, rev: 5? CCGTCAATTYYTTTRAGTTT). The data also include two 23S rRNA gene Sanger sequences from Rhabdochlamydia bacteria from the microbiomes of Alaskan Primnoa corals. The 23S rRNA gene was amplified using forward primer 5? GATGCCTTGGCATTGATAGGCGATGAAGGA and reverse primer 5? TGGCTCATCATGCAAAAGGCA. Samples from Baltimore Canyon (in the Atlantic Ocean) were collected in 2012. Samples from Norfolk Canyon (in the Atlantic Ocean) were collected in 2012-2013. Samples from the Gulf of Alaska (Tracy Arm Fjord) were collected in 2011-2012. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA348705. The 23S sequences have been submitted to NCBI (GenBank) under accession numbers KY010287 and KY010288. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Primnoa_metadata.txt", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: [email protected].

Info
Seafloor Elevation Change From 2016 to 2017 at Crocker Reef, Florida Keys-Impacts From Hurricane Irma

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify bathymetric changes at Crocker Reef near Islamorada, Florida (FL), within a 33.6 square-kilometer area following the landfall of Hurricane Irma in September 2017. USGS staff used light detection and ranging (lidar)-derived data acquired by the National Oceanic and Atmospheric Administration (NOAA) between July 21 and November 21, 2016 and USGS multibeam data collected between October 10 and December 8, 2017 (Fredericks and others, 2019) to assess changes in seafloor elevation and structure that occurred after the passage of Hurricane Irma. An elevation change analysis between the 2016 NOAA lidar data and the 2017 multibeam data was performed to quantify and map impacts to seafloor elevations and to determine elevation and volume change statistics for nine habitat types found at Crocker Reef, FL. Data were collected under Florida Keys National Marine Sanctuary permit FKNMS-2016-068.

Info
Shallow Along Reef Track Imaging System (sATRIS) Images – Dry Tortugas, Florida, 2009

Underwater digital images, single-beam bathymetry, and global positioning system (GPS) data were collected June 13-14, 2009 at Pulaski Shoal within Dry Tortugas National Park, Florida, USA. A total of 195,406 images of the seafloor and water column were collected along pre-defined transect lines and organized into 3 sets: track1, track2, and track3. This data release contains a subset of those images (32,135 images), all of which were used for benthic habitat classification, and contain GPS data. The data were collected using the U.S. Geological Survey (USGS) shallow Along Track Reef Imaging System (sATRIS), a boat-based, pole-mounted sensor package for mapping shallow-water benthic environments. Two other implementations exist: A towed system called Deep ATRIS and a profiling system called Drift ATRIS. All three ATRIS implementations incorporate a digital still camera and an acoustic depth sounder.

Info
Shallow Along Track Reef Imaging System (sATRIS) Images – Dry Tortugas, Florida, 2011

Underwater digital images, single-beam bathymetry, and global positioning system (GPS) data were collected July 13 to July 17, 2011 within Dry Tortugas National Park, Florida, USA. A total of 272,828 images of the seafloor and water column were collected along pre-defined transect lines and organized into 14 sets, track1-track14. This data release contains a subset of those images (43,991 images), all of which were used for benthic habitat classification and contain GPS data. The data were collected using the U.S. Geological Survey (USGS) shallow Along Track Reef Imaging System (sATRIS), a boat-based, pole-mounted sensor package for mapping shallow-water benthic environments. Two other implementations exist: A towed system called Deep ATRIS and a profiling system called Drift ATRIS. All three ATRIS implementations incorporate a digital still camera and an acoustic depth sounder.

Info
EAARL Coastal Topography and Imagery--Western Louisiana, Post-Hurricane Rita, 2005: First Surface

ASCII xyz and binary point-cloud data, as well as a digital elevation model (DEM) of a portion of the Louisiana coastline, post-Hurricane Rita (September 2005 hurricane), was produced from remotely sensed, geographically referenced elevation measurements cooperatively by the U.S. Geological Survey (USGS) and the National Aeronautics and Space Administration (NASA). Elevation measurements were collected over the area using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of +/-15 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL-B Coastal Topography--Eastern New Jersey, Hurricane Sandy, 2012: First Surface

ASCII xyz and binary point-cloud data, as well as a digital elevation model (DEM) of a portion of the New Jersey coastline, pre- and post-Hurricane Sandy (October 2012 hurricane), were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5 - 1.6 meters. A bias correction of -16 centimeters was applied as a result of instrument calibrations, yielding a nominal vertical elevation accuracy expressed as the root mean square error (RMSE) of 20 centimeters. A peak sampling rate of 15 - 30 kilohertz results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3-to-4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL-B Submerged Topography—Barnegat Bay, New Jersey, pre-Hurricane Sandy, 2012

American Standard Code for Information Interchange XYZ and binary point-cloud data, as well as a digital elevation model for part of Barnegat Bay, New Jersey, pre-Hurricane Sandy (October 2012 hurricane), were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar, a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. The nominal vertical elevation accuracy expressed as the root mean square error (RMSE) is 20 centimeters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL-B Submerged Topography—Barnegat Bay, New Jersey, post-Hurricane Sandy, 2012–2013

American Standard Code Information Interchange XYZ and binary point-cloud data, as well as a digital elevation model for part of Barnegat Bay, New Jersey, post-Hurricane Sandy (October 2012 hurricane), were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar, a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5–1.6 meters. The nominal vertical elevation accuracy expressed as the root mean square error (RMSE) is 25 centimeters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL-B Coastal Topography--Chandeleur Islands, Louisiana, 2012: Seamless (Bare Earth and Submerged) (.shp file)

This shapefile was produced from 52 2-kilometer by 2-kilometer tile extents of remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5 - 1.6 meters. The nominal vertical elevation accuracy expressed as the root mean square error (RMSE) is 15 centimeters. A peak sampling rate of 15 - 30 kilohertz results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography–Eastern Louisiana Barrier Islands, 09 March 2008: First Surface

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over some of the eastern Louisiana barrier islands in cooperation with the National Park Service (NPS), using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography–Eastern Louisiana Barrier Islands Barrier Islands, 09 March 2008: First Surface

A Digital Elevation Model (DEM) mosaic was data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over some of the eastern Louisiana barrier islands in cooperation with the National Park Service (NPS), using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
Lidar-Derived Classified Bare-Earth Point-Cloud for Coastal Topography—Fire Island, New York, 07 May 2012

Binary point-cloud data were produced for Fire Island, New York, from remotely sensed, geographically referenced elevation measurements collected by Photo Science, Inc. using an Optech Gemini lidar sensor flown on a Cessna 206 aircraft.

Info
Lidar-Derived Bare-Earth Digital Elevation Model (DEM) Mosaic for Coastal Topography—Fire Island, New York, 07 May 2012

A digital elevation model (DEM) mosaic was produced for Fire Island, New York, from remotely sensed, geographically referenced elevation measurements collected by Photo Science, Inc. using an Optech Gemini lidar sensor flown on a Cessna 206 aircraft

Info
Calibrated EAARL-B Submerged Topography--Fort Lauderdale, Florida, 2014 (GEOID12A)

Binary point-cloud data of a portion of the submerged environs of Fort Lauderdale, Florida, were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser pulse and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. The EAARL, developed originally by the National Aeronautics and Space Administration (NASA) at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
Calibrated EAARL-B Submerged Topography--Fort Lauderdale, Florida, 2014 (WGS84)

Binary point-cloud data of a portion of the submerged environs of Fort Lauderdale, Florida, were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser pulse and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. The EAARL, developed originally by the National Aeronautics and Space Administration (NASA) at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
Uncalibrated EAARL-B Submerged Topography--Fort Lauderdale, Florida, 2014 (GEOID12A)

Binary point-cloud data of a portion of the submerged environs of Fort Lauderdale, Florida, were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser pulse and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. The EAARL, developed originally by the National Aeronautics and Space Administration (NASA) at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
Uncalibrated EAARL-B Submerged Topography--Fort Lauderdale, Florida, 2014 (WGS84)

Binary point-cloud data of a portion of the submerged environs of Fort Lauderdale, Florida, were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser pulse and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. The EAARL, developed originally by the National Aeronautics and Space Administration (NASA) at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
Shallow ATRIS Seafloor Images - West Turtle Shoal Patch Reef, Rawa PatchReef, Dustan Rocks Patch Reef, and Thor Patch Reef, Florida, 2011

Underwater digital images, single-beam bathymetry, and global-positioning system (GPS) data were collected September 29-30, 2011 around Dustan Rocks Patch Reef, Thor Patch Reef, West Turtle Shoal Patch Reef, and Rawa Patch Reef in the Florida Keys. A total of 101,734 images were collected, covering 4672 square meteres (m2) of reef habitat. This data release contains a subset of 1,420 images, organized into four sets: Track1, Track2, Track3, and Track4. These images were used for coral bleaching assessments, contain GPS data and also include additional, survey-specific Exchangable Image File format (EXIF) header information. The data were collected using the USGS shallow Along-Track Reef-Imaging System (sATRIS), a boat-based, pole-mounted sensor package for mapping shallow-water benthic environments. Two other implementations exist: A towed system called Deep ATRIS and a profiling system called Drift ATRIS. All three ATRIS implementations incorporate a digital still camera, a video camera, and an acoustic depth sounder. In this study, sATRIS images were collected at a rate of 10 hertz (Hz), the single-beam depth soundings at 10 Hz, and the GPS data at 1 Hz. The survey was conducted using the USGS research vessel (R/V) Halimeda, running at a nominal speed of 2 knots.

Info
Using fossilized charcoal to corroborate the Everglades fire history geodatabase

Fire in the Everglades National Park (ENP) has historically been influential in shaping the Everglades ecosystem. As a result, ENP has been documenting fire events since 1948, and these data have been incorporated into an Esri ArcGIS geodatabase (Smith, T.J. III, and others, 2015). According to this geodatabase, 757,078 hectares of wetlands burned from 1948 to 2011. The main type of vegetation that has burned is comprised of palustrine and estuarine wetlands; however, there are areas in ENP that are comprised of these wetlands but have no documented fire events. Consequently, scientists at the USGS St. Petersburg Coastal and Marine Science Center question the accuracy of the data in this geodatabase. The abundance of fossil charcoal in sediment cores has been used, historically, as a fire proxy so to test the accuracy of this data, USGS scientists examined fossil charcoal in sediment cores taken from six locations in ENP. Two of the cores were taken from areas with well-documented fire events and four cores where taken from areas with no documented fire events. USGS scientists also dated three of the cores using excess Lead-210 (210Pb). Based on charcoal abundance in these cores, USGS scientists were able to verify documented fire events in the geodatabase. Furthermore, the presence of fossil charcoal in cores from areas with no documented fire events indicate that fire events did, in fact, occur in these areas in 1948-1964 and 1950-1980. These findings indicate the presence of fire events that are undocumented in the Esri geodatabase and suggest that 210Pb-dating is a promising method for reconstructing a regional fire history.

Info
EAARL Coastal Topography–Texas, Post-Hurricane Ike, 2008: Bare Earth

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over a portion of the Texas coastline, post-Hurricane Ike (September 2008 hurricane), using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by the National Aeronautics and Space Administration (NASA) at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography–Texas, Post-Hurricane Ike, 2008: First Surface

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over a portion of the Texas coastline, post-Hurricane Ike (September 2008 hurricane), using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by the National Aeronautics and Space Administration (NASA) at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography--Chandeleur Islands, Louisiana, Post-Hurricane Katrina, 2005: Bare Earth

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements acquired by the U.S. Geological Survey (USGS). Elevation measurements were collected over the Chandeleur Islands, post-Hurricane Katrina (August 2005 hurricane), using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography--Chandeleur Islands, Louisiana, Post-Hurricane Katrina, 2005: First Surface

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements acquired by the U.S. Geological Survey (USGS). Elevation measurements were collected over the Chandeleur Islands, post-Hurricane Katrina (August 2005 hurricane), using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography--Dauphin Island, Alabama, Post-Hurricane Katrina, 2005: Bare Earth

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over Dauphin Island, post-Hurricane Katrina (August 2005 hurricane), using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography--Dauphin Island, Alabama, Post-Hurricane Katrina, 2005: First Surface

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over Dauphin Island, post-Hurricane Katrina (August 2005 hurricane), using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography–Northwest Florida, Post-Hurricane Katrina, 2005: Bare Earth

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over northwest Florida, post-Hurricane Katrina (August 2005 hurricane), using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography–Northwest Florida, Post-Hurricane Katrina, 2005: First Surface

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over northwest Florida, post-Hurricane Katrina (August 2005 hurricane), using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
Lower Florida Keys-Seafloor elevation change in Maui, St. Croix, St. Thomas, and the Florida Keys

Coral reefs serve as natural barriers that protect adjacent shorelines from coastal hazards such as storms, waves and erosion but projections indicate global degradation of coral reefs due to anthropogenic impacts and climate change will cause a transition to net erosion by mid-century. The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by measuring regional-scale changes in seafloor elevation. USGS staff assessed five coral reef ecosystems in the Atlantic Ocean (Upper and Lower Florida Keys), Caribbean Sea (U.S. Virgin Islands: St. Thomas and Buck Island, St. Croix), and Pacific Ocean (Maui, Hawaii), including both coral-dominated and adjacent, non-coral dominated habitats. Scientists used historical bathymetric data from the 1930s to 1980s and contemporary light detection and ranging (lidar) digital elevation models (DEMs) from the late 1990s to 2000s to calculate changes in seafloor elevation for each study site over time periods reflecting low to high anthropogenic impacts. LFK_ElevationChange.zip contains the location, elevation, and elevation change data for the Lower Florida Keys. Using these changes in elevation, further analysis was done to calculate corresponding changes in seafloor volume for all study areas and habitat types within each site.

Info
Seafloor Elevation Change From 2004 to 2016 at Looe Key, Florida Keys

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify bathymetric changes at Looe Key near Big Pine Key, Florida (FL), within a 16.4 square-kilometer area between 2004 and 2016. USGS staff used light detection and ranging (lidar)-derived data acquired by the U.S. Army Corps of Engineers (USACE) Joint Airborne Lidar Bathymetry Technical Center of eXpertise (JALBTCX) between December 1 and 31, 2004 (USACE-JALBTCX) and the National Oceanic and Atmospheric Administration (NOAA) between July 21 and November 21, 2016 (NOAA, 2017) to assess changes in seafloor elevation and structure that occurred during this time. An elevation change analysis between the 2004 USACE and 2016 NOAA lidar data was performed to quantify and map impacts to seafloor elevation and determine elevation and volume change statistics for ten habitat types found at Looe Key. Data were collected under Florida Keys National Marine Sanctuary permit FKNMS-2016-068.

Info
Seafloor Elevation Change From 2016 to 2017 at Looe Key, Florida Keys-Impacts From Hurricane Irma (version 2.0)

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify bathymetric changes at Looe Key near Big Pine Key, Florida (FL), within a 19.7 square-kilometer area following Hurricane Irma's landfall in September 2017. USGS staff used light detection and ranging (lidar)-derived data acquired by the National Oceanic and Atmospheric Administration (NOAA) between July 21 and November 21, 2016 and USGS multibeam data collected December 12-17, 2017 (Fredericks and others, 2019) to assess changes in seafloor elevation and structure that occurred after the passage of Hurricane Irma. An elevation change analysis between the 2016 NOAA lidar data and the 2017 USGS multibeam data was performed to quantify and map impacts to seafloor elevation and determine elevation and volume change statistics for ten habitat types found at Looe Key. Data were collected under Florida Keys National Marine Sanctuary permit FKNMS-2016-068.

Info
Maui, Hawaii-Seafloor elevation change in Maui, St. Croix, St. Thomas, and the Florida Keys

Coral reefs serve as natural barriers that protect adjacent shorelines from coastal hazards such as storms, waves and erosion but projections indicate global degradation of coral reefs due to anthropogenic impacts and climate change will cause a transition to net erosion by mid-century. The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by measuring regional-scale changes in seafloor elevation. USGS staff assessed five coral reef ecosystems in the Atlantic Ocean (Upper and Lower Florida Keys), Caribbean Sea (U.S. Virgin Islands: St. Thomas and Buck Island, St. Croix), and Pacific Ocean (Maui, Hawaii), including both coral-dominated and adjacent, non-coral dominated habitats. Scientists used historical bathymetric data from the 1930s to 1980s and contemporary light detection and ranging (lidar) digital elevation models (DEMs) from the late 1990s to 2000s to calculate changes in seafloor elevation for each study site over time periods reflecting low to high anthropogenic impacts. Maui_ElevationChange.zip contains the location, elevation, and elevation change data for Maui, Hawaii. Using these changes in elevation, further analysis was done to calculate corresponding changes in seafloor volume for all study areas and habitat types within each site

Info
Sedimentary Data from the Coastal Marshes Fringing the Lower Waccasassa River, Northwest Florida

Scientists from the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center extracted sediment and surface samples along transects at three saltmarsh sites situated on the lower end of the Waccasassa River in north-west Florida in order to increase understanding of the region’s environmental history and the ongoing soil chemical processes. To this end, they obtained 17 (ten long and seven short) sediment cores and seven surface samples from saltmarshes along the margins of the river, during field trips in November 2014 and February 2015. Site names are WC01, WC04, WC05, WC10, WC11, WC12, WC20, WC21, WC22, and WC23. Long cores from each location are given the location name and the suffix “R”, surface samples are noted with a “S”, and short cores are given the location name and the suffix “D”, except for the cores taken at sites WC22 and WC23. At those two sites, the short cores were obtained by extracting two parallel peat auger samples to a depth of 50 cm, named WC22Ra-b, and WC23Ra-b, respectively.

Info
EAARL Coastal Topography–Texas, Post-Hurricane Rita, 2005: Bare Earth

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over a portion of the Texas coastline, post-Hurricane Rita (September 2005 hurricane), using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by the National Aeronautics and Space Administration (NASA) at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography–Texas, Post-Hurricane Rita, 2005: First Return

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over a portion of the Texas coastline, post-Hurricane Rita (September 2005 hurricane), using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by the National Aeronautics and Space Administration (NASA) at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL-B Topography—Suncook River, New Hampshire, 5-6 November 2013: Seamless (Bare Earth and Submerged)

Binary point-cloud data for part of the Suncook River in New Hampshire were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey, in cooperation with the New Hampshire Geological Survey. Elevation measurements were collected over the area on November 5 and 6, 2013 using the second-generation Experimental Advanced Airborne Research Lidar, a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters. A peak sampling rate of 15–30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
St. Croix, U.S. Virgin Islands—Seafloor elevation change in Maui, St. Croix, St. Thomas, and the Florida Keys

Coral reefs serve as natural barriers that protect adjacent shorelines from coastal hazards such as storms, waves and erosion but projections indicate global degradation of coral reefs due to anthropogenic impacts and climate change will cause a transition to net erosion by mid-century. The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by measuring regional-scale changes in seafloor elevation. USGS staff assessed five coral reef ecosystems in the Atlantic Ocean (Upper and Lower Florida Keys), Caribbean Sea (U.S. Virgin Islands: Saint Thomas and Buck Island, St. Croix), and Pacific Ocean (Maui, Hawaii), including both coral-dominated and adjacent, non-coral dominated habitats. Scientists used historical bathymetric data from the 1930s to 1980s and contemporary light detection and ranging (lidar) digital elevation models (DEMs) from the late 1990s to 2000s to calculate changes in seafloor elevation for each study site over time periods reflecting low to high anthropogenic impacts. STC_ElevationChange.zip contains the location, elevation, and elevation change data for Buck Island-St.Croix, U.S. Virgin Islands. Using these changes in elevation, further analysis was done to calculate corresponding changes in seafloor volume for all study areas and habitat types within each site.

Info
Lidar-Derived Point Cloud for EAARL-B Submerged Topography–—Saint Thomas, U.S. Virgin Islands, 2014

ASCII XYZ point cloud data for a portion of the submerged environs of Saint Thomas, U.S. Virgin Islands, was produced from remotely sensed, geographically referenced elevation measurements collected on March 7, 8, 11, 12, 13, 14, 17, 18, and 24, 2014 by the U.S. Geological Survey, in collaboration with the National Oceanic and Atmospheric Administration (NOAA) Coral Reef Conservation Program. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. The nominal vertical elevation accuracy expressed as the root mean square error (RMSE) is 13.5 centimeters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
Lidar-Derived Digital Elevation Model (DEM) Mosaic for EAARL-B Submerged Topography-Saint Thomas, U.S. Virgin Islands, 2014

A submerged topography Digital Elevation Model (DEM) mosaic for a portion of the submerged environs of Saint Thomas, U.S. Virgin Islands, was produced from remotely sensed, geographically referenced elevation measurements collected on March 7, 8, 11, 12, 13, 14, 17, 18, and 24, 2014 by the U.S. Geological Survey, in collaboration with the National Oceanic and Atmospheric Administration (NOAA) Coral Reef Conservation Program. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. The nominal vertical elevation accuracy expressed as the root mean square error (RMSE) is 13.5 centimeters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
St. Thomas, U.S. Virgin Islands-Seafloor elevation change in Maui, St. Croix, St. Thomas, and the Florida Keys

Coral reefs serve as natural barriers that protect adjacent shorelines from coastal hazards such as storms, waves and erosion but projections indicate global degradation of coral reefs due to anthropogenic impacts and climate change will cause a transition to net erosion by mid-century. The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by measuring regional-scale changes in seafloor elevation. USGS staff assessed five coral reef ecosystems in the Atlantic Ocean (Upper and Lower Florida Keys), Caribbean Sea (U.S. Virgin Islands: St. Thomas and Buck Island, St. Croix), and Pacific Ocean (Maui, Hawaii), including both coral-dominated and adjacent, non-coral dominated habitats. Scientists used historical bathymetric data from the 1930s to 1980s and contemporary light detection and ranging (lidar) digital elevation models (DEMs) from the late 1990s to 2000s to calculate changes in seafloor elevation for each study site over time periods reflecting low to high anthropogenic impacts. STT_ElevationChange.zip contains the location, elevation, and elevation change data for St. Thomas, U.S. Virgin Islands. Using these changes in elevation, further analysis was done to calculate corresponding changes in seafloor volume for all study areas and habitat types within each site.

Info
Seafloor Elevation Change From 2017 to 2018 at a Subsection of Crocker Reef, Florida Keys-Impacts from Hurricane Irma

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify bathymetric changes at a subsection of Crocker Reef near Islamorada, Florida (FL), within a 6.1 square-kilometer area following the landfall of Hurricane Irma in September 2017. USGS staff used USGS multibeam data collected between October 10 and December 8, 2017 (Fredericks and others, 2019) and March 8-15, 2018 (Fredericks and others, 2019) to assess changes in seafloor elevation and structure in the months following the passage of Hurricane Irma. An elevation change analysis between the 2017 and 2018 USGS multibeam data was performed to quantify and map impacts to seafloor elevations and to determine elevation and volume change statistics for seven habitat types found within a subsection of Crocker Reef, FL.

Info
Upper Florida Keys-Seafloor elevation change in Maui, St. Croix, St. Thomas, and the Florida Keys

Coral reefs serve as natural barriers that protect adjacent shorelines from coastal hazards such as storms, waves and erosion but projections indicate global degradation of coral reefs due to anthropogenic impacts and climate change will cause a transition to net erosion by mid-century. The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by measuring regional-scale changes in seafloor elevation. USGS staff assessed five coral reef ecosystems in the Atlantic Ocean (Upper and Lower Florida Keys), Caribbean Sea (U.S. Virgin Islands: St. Thomas and Buck Island, St. Croix), and Pacific Ocean (Maui, Hawaii), including both coral-dominated and adjacent, non-coral dominated habitats. Scientists used historical bathymetric data from the 1930s to 1980s and contemporary light detection and ranging (lidar) digital elevation models (DEMs) from the late 1990s to 2000s to calculate changes in seafloor elevation for each study site over time periods reflecting low to high anthropogenic impacts. UFK_ElevationChange.zip contains the location, elevation, and elevation change data for the Upper Florida Keys. Using these changes in elevation, further analysis was done to calculate corresponding changes in seafloor volume for all study areas and habitat types within each site.

Info
EAARL Coastal Topography--Eastern Florida, Post-Hurricane Jeanne, 2004: Bare Earth

A digital elevation model (DEM) of a portion of the eastern Florida coastline, post-Hurricane Jeanne (September 2004 hurricane), was produced from remotely sensed, geographically referenced elevation measurements cooperatively by the U.S. Geological Survey (USGS) and the National Aeronautics and Space Administration (NASA). Elevation measurements were collected over the area using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of +/-15 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development. For more information on Lidar science and the Experimental Advanced Airborne Research Lidar (EAARL) system and surveys, see http://ngom.usgs.gov/dsp/overview/index.php and http://ngom.usgs.gov/dsp/tech/eaarl/index.php .

Info
EAARL Coastal Topography--Eastern Florida, Post-Hurricane Jeanne, 2004: Bare Earth

A digital elevation model (DEM) of a portion of the eastern Florida coastline, post-Hurricane Jeanne (September 2004 hurricane), was produced from remotely sensed, geographically referenced elevation measurements cooperatively by the U.S. Geological Survey (USGS) and the National Aeronautics and Space Administration (NASA). Elevation measurements were collected over the area using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of +/-15 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development. For more information on Lidar science and the Experimental Advanced Airborne Research Lidar (EAARL) system and surveys, see http://ngom.usgs.gov/dsp/overview/index.php and http://ngom.usgs.gov/dsp/tech/eaarl/index.php .

Info
EAARL Coastal Topography--Eastern Florida, Post-Hurricane Jeanne, 2004: Bare Earth

A digital elevation model (DEM) of a portion of the eastern Florida coastline, post-Hurricane Jeanne (September 2004 hurricane), was produced from remotely sensed, geographically referenced elevation measurements cooperatively by the U.S. Geological Survey (USGS) and the National Aeronautics and Space Administration (NASA). Elevation measurements were collected over the area using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of +/-15 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development. For more information on Lidar science and the Experimental Advanced Airborne Research Lidar (EAARL) system and surveys, see http://ngom.usgs.gov/dsp/overview/index.php and http://ngom.usgs.gov/dsp/tech/eaarl/index.php .

Info
EAARL Coastal Topography--Eastern Florida, Post-Hurricane Jeanne, 2004: Bare Earth

A digital elevation model (DEM) of a portion of the eastern Florida coastline, post-Hurricane Jeanne (September 2004 hurricane), was produced from remotely sensed, geographically referenced elevation measurements cooperatively by the U.S. Geological Survey (USGS) and the National Aeronautics and Space Administration (NASA). Elevation measurements were collected over the area using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of +/-15 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development. For more information on Lidar science and the Experimental Advanced Airborne Research Lidar (EAARL) system and surveys, see http://ngom.usgs.gov/dsp/overview/index.php and http://ngom.usgs.gov/dsp/tech/eaarl/index.php .

Info
EAARL Coastal Topography--Eastern Florida, Post-Hurricane Jeanne, 2004: Bare Earth

A digital elevation model (DEM) of a portion of the eastern Florida coastline, post-Hurricane Jeanne (September 2004 hurricane), was produced from remotely sensed, geographically referenced elevation measurements cooperatively by the U.S. Geological Survey (USGS) and the National Aeronautics and Space Administration (NASA). Elevation measurements were collected over the area using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of +/-15 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development. For more information on Lidar science and the Experimental Advanced Airborne Research Lidar (EAARL) system and surveys, see http://ngom.usgs.gov/dsp/overview/index.php and http://ngom.usgs.gov/dsp/tech/eaarl/index.php .

Info
EAARL Coastal Topography--Virginia, Post-Nor'Ida, 2009

A digital elevation model (DEM) of a portion of the Virginia coastline beachface, post-Nor'Ida (November 2009 nor'easter), was produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The EAARL sensor suite includes the raster-scanning, water-penetrating full-waveform adaptive lidar, a down-looking red-green-blue (RGB) digital camera, a high-resolution multispectral color-infrared (CIR) camera, two precision dual frequency kinematic carrier-phase GPS receivers, and an integrated miniature digital inertial measurement unit, which provide for sub-meter georeferencing of each laser sample. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by the National Aeronautics and Space Administration (NASA) at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of +/-15 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography--Virginia, Post-Nor'Ida, 2009

A digital elevation model (DEM) of a portion of the Virginia coastline beachface, post-Nor'Ida (November 2009 nor'easter), was produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The EAARL sensor suite includes the raster-scanning, water-penetrating full-waveform adaptive lidar, a down-looking red-green-blue (RGB) digital camera, a high-resolution multispectral color-infrared (CIR) camera, two precision dual frequency kinematic carrier-phase GPS receivers, and an integrated miniature digital inertial measurement unit, which provide for sub-meter georeferencing of each laser sample. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by the National Aeronautics and Space Administration (NASA) at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of +/-15 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EAARL Coastal Topography--North Shore, Lake Pontchartrain, Louisiana, 2010

A digital elevation model (DEM) of a portion of the north shore of Lake Pontchartrain, Louisiana, was produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area on February 28, March 1, and March 5, 2010, using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by the National Aeronautics and Space Administration (NASA) at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of +/-15 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development. The data provided represent the last return pulses and were processed and filtered for bare-earth topography. However, in low-lying and emerging vegetation environments, bare-earth topography is not necessarily discernible from the last-return pulses. The difference in water levels between data collections on February 28, March 1, and March 5 resulted in elevation variations in the merged data.

Info
EAARL Coastal Topography--North Shore, Lake Pontchartrain, Louisiana, 2010

A digital elevation model (DEM) of a portion of the north shore of Lake Pontchartrain, Louisiana, was produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area on February 28, March 1, and March 5, 2010, using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by the National Aeronautics and Space Administration (NASA) at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of +/-15 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development. The data provided represent the last return pulses and were processed and filtered for bare-earth topography. However, in low-lying and emerging vegetation environments, bare-earth topography is not necessarily discernible from the last-return pulses. The difference in water levels between data collections on February 28, March 1, and March 5 resulted in elevation variations in the merged data.

Info
EAARL Coastal Topography--North Shore, Lake Pontchartrain, Louisiana, 2010

A digital elevation model (DEM) of a portion of the north shore of Lake Pontchartrain, Louisiana, was produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area on February 28, March 1, and March 5, 2010, using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by the National Aeronautics and Space Administration (NASA) at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of +/-15 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development. The data provided represent the last return pulses and were processed and filtered for bare-earth topography. However, in low-lying and emerging vegetation environments, bare-earth topography is not necessarily discernible from the last-return pulses. The difference in water levels between data collections on February 28, March 1, and March 5 resulted in elevation variations in the merged data.

Info
Coastal Topography--Northeast Atlantic Coast, Post-Hurricane Sandy, 2012: Lidar-extracted dune features

Dune crest and toe positions along a portion of the New York, Delaware, Maryland, Virginia, and North Carolina coastlines, post-Hurricane Sandy (Sandy was an October 2012 hurricane that made landfall as an extratropical cyclone on the 29th), were produced by the U.S. Geological Survey (USGS) from remotely sensed, geographically referenced elevation measurements collected by Photo Science, Inc. (Delaware, Maryland, Virginia, and North Carolina) and Woolpert, Inc. (Fire Island, New York)using using airborne lidar sensors.

Info
Coastal Topography--Northeast Atlantic Coast, Post-Hurricane Sandy, 2012: Lidar and digital elevation model (DEM) tile index

This data represents the tile index for lidar data collected for the U.S. Geological Survey in November 2012 following Hurricane Sandy, which made landfall in the eastern United States on October 29th, 2012. The lidar LAS and derived-digital elevation model (DEM) data are divided into these tiles and filenames match the tile number. The index shows the extent of data collection (portions of the coastline of New York, Delaware, Maryland, Virginia, and North Carolina) and provides tile names to aid in identifying files for data download.

Info
Projected Seafloor Elevation Change in the Upper Florida Keys, Florida: 25, 50, 75, and 100 years from 2002

The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by measuring regional-scale changes in seafloor elevation in the Upper Florida Keys, Florida, including both coral-dominated habitats and adjacent, non-coral-dominated habitats. USGS staff used historical bathymetric data from the 1930’s and light detection and ranging (lidar)-derived data acquired in 2002 (Brock and others, 2006, 2007) to calculate changes in seafloor elevation (Yates and others, 2017). Using these changes in seafloor elevation, further analyses were conducted that calculated annual erosion rates and utilized those results to project seafloor elevation changes 25, 50, 75, and 100 years from 2002.

Info
08ACH03_first_return_metadata: EAARL Coastal Topography-Louisiana, Alabama, and Florida, June 2008

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
08ACH03_first_return_metadata: EAARL Coastal Topography-Louisiana, Alabama, and Florida, June 2008

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
08ACH03_last_return_metadata: EAARL Coastal Topography-Louisiana, Alabama, and Florida, June 2008

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
08ACH03_last_return_metadata: EAARL Coastal Topography-Louisiana, Alabama, and Florida, June 2008

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over the area using the National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 50 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
ANGD2014_BE_z20_n88g12A_mosaic_metadata: Lidar-Derived Bare-Earth Digital Elevation Model (DEM) Mosaic for Coastal Topography—Anegada, British Virgin Islands, 2014

A digital elevation model (DEM) mosaic was produced for Anegada, British Virgin Islands, from remotely sensed, geographically referenced elevation measurements collected by Watershed Sciences, Inc. (WSI)/Quantum Spatial using an Optech Orion M300 (1064-nm wavelength) lidar sensor on January 21, 2014.

Info
ANGD2014_EAARLB_z20_v09g12A_metadata: Lidar-Derived Seamless (Bare Earth and Submerged) Point Cloud for Coastal Topography—Anegada, British Virgin Islands, 2014

ASCII XYZ point cloud data for a portion of the environs of Anegada, British Virgin Islands, was produced from remotely sensed, geographically referenced elevation measurements collected March 19-20, 2014 by the U.S. Geological Survey. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. The nominal vertical elevation accuracy expressed as the root mean square error (RMSE) is 20 centimeters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
ANGD2014_EAARLB_z20_v09g12A_mosaic_metadata: Lidar-Derived Seamless (Bare Earth and Submerged) Digital Elevation Model (DEM) Mosaic for Coastal Topography—Anegada, British Virgin Islands, 2014

A seamless (bare earth and submerged) topography Digital Elevation Model (DEM) mosaic for a portion of the submerged environs of Anegada, British Virgin Islands, was produced from remotely sensed, geographically referenced elevation measurements collected March 19-20, 2014 by the U.S. Geological Survey. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. The nominal vertical elevation accuracy expressed as the root mean square error (RMSE) is 20 centimeters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
ASIS2003_EAARLA_BE_z18_n88g99_metadata: EAARL Coastal Topography--Northern Assateague Island National Seashore, Maryland and Virginia, 2003: Bare Earth

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements acquired cooperatively by the U.S. Geological Survey (USGS) and the National Park Service (NPS). Elevation measurements were collected over northern Assateague Island National Seashore using the first-generation National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
ASIS2003_EAARLA_BE_z18_n88g99_mosaic_metadata: EAARL Coastal Topography--Northern Assateague Island National Seashore, Maryland and Virginia, 2003: Bare Earth

A bare-earth topography Digital Elevation Model (DEM) mosaic for the northern half of Assateague Island National Seashore was produced from remotely sensed, geographically referenced elevation measurements acquired cooperatively by the U.S. Geological Survey (USGS) and the National Park Service (NPS). Elevation measurements were collected over northern Assateague Island National Seashore using the first-generation National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
ASIS2005_EAARLA_BE_z18_n88g12B_metadata: EAARL Coastal Topography--Assateague Island National Seashore, Maryland and Virginia, 2005: Bare Earth

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements acquired cooperatively by the U.S. Geological Survey (USGS) and the National Park Service (NPS). Elevation measurements were collected over Assateague Island National Seashore using the first-generation National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
ASIS2005_EAARLA_BE_z18_n88g12B_mosaic_metadata: EAARL Coastal Topography--Assateague Island National Seashore, Maryland and Virginia, 2005: Bare Earth

A bare-earth topography Digital Elevation Model (DEM) mosaic for the Assateague Island National Seashore was produced from remotely sensed, geographically referenced elevation measurements acquired cooperatively by the U.S. Geological Survey (USGS) and the National Park Service (NPS). Elevation measurements were collected over Assateague Island National Seashore using the first-generation National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
ASIS2005_EAARLA_FS_z18_n88g12B_metadata: EAARL Coastal Topography--Assateague Island National Seashore, Maryland and Virginia, 2005: First Surface

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements acquired cooperatively by the U.S. Geological Survey (USGS) and the National Park Service (NPS). Elevation measurements were collected over Assateague Island National Seashore using the first-generation National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
ASIS2005_EAARLA_FS_z18_n88g12B_mosaic_metadata: EAARL Coastal Topography--Assateague Island National Seashore, Maryland and Virginia, 2005: First Surface

A first-surface topography Digital Elevation Model (DEM) mosaic for the Assateague Island National Seashore was produced from remotely sensed, geographically referenced elevation measurements acquired cooperatively by the U.S. Geological Survey (USGS) and the National Park Service (NPS). Elevation measurements were collected over Assateague Island National Seashore using the first-generation National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
ASIS2015_HRJQ_BE_z18_n88g12B_classified_metadata: Lidar-Derived Classified Bare-Earth Point-Cloud for Coastal Topography—Assateague Island, Maryland and Virginia, Post-Hurricane Joaquin, 26 November 2015

Binary point-cloud data were produced for Assateague Island, Maryland and Virginia, post-Hurricane Joaquin, from remotely sensed, geographically referenced elevation measurements collected by Quantum Spatial using a Leica ALS70 (1064-nm wavelength) lidar sensor.

Info
ASIS2015_HRJQ_BE_z18_n88g12B_mosaic_metadata: Lidar-Derived Bare-Earth Digital Elevation Model (DEM) Mosaic for Coastal Topography—Assateague Island, Maryland and Virginia, Post-Hurricane Joaquin, 26 November 2015

A digital elevation model (DEM) mosaic was produced for Assateague Island, Maryland and Virginia, post-Hurricane Joaquin, from remotely sensed, geographically referenced elevation measurements collected by Quantum Spatial using a Leica ALS70 (1064-nm wavelength) lidar sensor.

Info
ASIS2016_HRHM_SM_z18_n88g12B_classified_metadata: Lidar-Derived Classified Point-Cloud for Coastal Topography—Assateague Island, Maryland and Virginia, Post-Hurricane Hermine, 10-12 September 2016

Binary point-cloud data were produced for Assateague Island, Maryland and Virginia, post-Hurricane Hermine, from remotely sensed, geographically referenced elevation measurements collected by Quantum Spatial using a Riegl VQ-880-G (532-nm wavelength circular scan and 1064-nm wavelength linear scan) lidar sensor.

Info
ASIS2016_HRHM_SM_z18_n88g12B_mosaic_metadata: Lidar-Derived Seamless Digital Elevation Model (DEM) Mosaic of Coastal Topography—Assateague Island, Maryland and Virginia, Post-Hurricane Hermine, 10-12 September 2016

A digital elevation model (DEM) mosaic was produced for Assateague Island, Maryland and Virginia, post-Hurricane Hermine, from remotely sensed, geographically referenced elevation measurements collected by Quantum Spatial using a Riegl VQ-880-G (532-nm wavelength circular scan and 1064-nm wavelength linear scan) lidar sensor.

Info
BITH2014_BeaumontLNRUnits_EAARLB_BE_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Beaumont and Lower Neches River Units, Texas, 2014

A bare-earth topography Digital Elevation Model (DEM) mosaic for the Beaumont and Lower Neches River Units of Big Thicket National Preserve in Texas, was produced from remotely sensed, geographically referenced elevation measurements collected on January 11, 15, 17, 18, 19, 21, 22, 23, 25, 26, 27, and 29, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_BeaumontLNRUnits_EAARLB_FS_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Beaumont and Lower Neches River Units, Texas, 2014

A first-surface topography Digital Elevation Model (DEM) mosaic for the Beaumont and Lower Neches River Units of Big Thicket National Preserve in Texas, was produced from remotely sensed, geographically referenced elevation measurements collected on January 11, 15, 17, 18, 19, 21, 22, 23, 25, 26, 27, and 29, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_BigSandyCreekCorridorUnit_EAARLB_BE_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Big Sandy Creek Corridor Unit, Texas, 2014

A bare-earth topography Digital Elevation Model (DEM) mosaic for the Big Sandy Creek Corridor Unit of Big Thicket National Preserve in Texas was produced from remotely sensed, geographically referenced elevation measurements collected on January 19, 21, 22, 29, and 30, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point density of 1.4 points per square meter. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_BigSandyCreekCorridorUnit_EAARLB_FS_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Big Sandy Creek Corridor Unit, Texas, 2014

A first-surface topography Digital Elevation Model (DEM) mosaic for the Big Sandy Creek Corridor Unit of Big Thicket National Preserve in Texas was produced from remotely sensed, geographically referenced elevation measurements collected on January 19, 21, 22, 29, and 30, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point density of 1.4 points per square meter. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_BigSandyCreekUnit_EAARLB_BE_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Big Sandy Creek Unit, Texas, 2014

A bare-earth topography digital elevation model (DEM) mosaic for the Big Sandy Creek Unit of Big Thicket National Preserve in Texas, was produced from remotely sensed, geographically referenced elevation measurements collected on January 19, 21, 22, and 30, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar, a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_BigSandyCreekUnit_EAARLB_FS_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Big Sandy Creek Unit, Texas, 2014

A first-surface topography digital elevation model (DEM) mosaic for the Big Sandy Creek Unit of Big Thicket National Preserve in Texas, was produced from remotely sensed, geographically referenced elevation measurements collected on January 19, 21, 22, and 30, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar, a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_CanyonlandsUNRCorridorUnits_EAARLB_BE_z15_n88g12A_mosaic_metadata: Lidar-Derived Bare-Earth Digital Elevation Model (DEM) Mosaic for EAARL-B Topography—Big Thicket National Preserve: Canyonlands and Upper Neches River Corridor Units, Texas, 2014

A bare-earth topography Digital Elevation Model (DEM) mosaic for the Canyonlands and Upper Neches River Corridor Units of Big Thicket National Preserve in Texas was produced from remotely sensed, geographically referenced elevation measurements collected on January 11, 15, 17, 18, 21, 23, 25, and 29, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point density of 1.4 points per square meter. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_CanyonlandsUNRCorridorUnits_EAARLB_FS_z15_n88g12A_mosaic_metadata: Lidar-derived First-Surface Digital Elevation Model (DEM) Mosaic for EAARL-B Topography—Big Thicket National Preserve: Canyonlands and Upper Neches River Corridor Units, Texas, 2014

A first-surface topography Digital Elevation Model (DEM) mosaic for the Canyonlands and Upper Neches River Corridor Units of Big Thicket National Preserve in Texas was produced from remotely sensed, geographically referenced elevation measurements collected on January 11, 15, 17, 18, 21, 23, 25, and 29, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point density of 1.4 points per square meter. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_LanceRosierUnit_EAARLB_BE_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Lance Rosier Unit, Texas, 2014

A bare-earth topography Digital Elevation Model (DEM) mosaic for the Lance Rosier Unit of Big Thicket National Preserve in Texas, was produced from remotely sensed, geographically referenced elevation measurements collected on January 15, 21, 22, 25, 26, and 30, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_LanceRosierUnit_EAARLB_FS_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Lance Rosier Unit, Texas, 2014

A first-surface topography Digital Elevation Model (DEM) mosaic for the Lance Rosier Unit of Big Thicket National Preserve in Texas, was produced from remotely sensed, geographically referenced elevation measurements collected on January 15, 21, 22, 25, 26, and 30, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_LittlePineIslandBayouCorridorUnit_EAARLB_BE_z15_n88g12A_mosaic_metadata: Lidar-Derived Bare-Earth Digital Elevation Model (DEM) Mosaic for EAARL-B Topography—Big Thicket National Preserve: Little Pine Island Bayou Corridor Unit, Texas, 2014

A bare-earth topography Digital Elevation Model (DEM) mosaic for the Little Pine Island Bayou Corridor Unit of Big Thicket National Preserve in Texas was produced from remotely sensed, geographically referenced elevation measurements collected on January 15, 21, 22, 26, and 30, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point density of 1.4 points per square meter. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_LittlePineIslandBayouCorridorUnit_EAARLB_FS_z15_n88g12A_mosaic_metadata: Lidar-Derived First-Surface Digital Elevation Model (DEM) Mosaic for EAARL-B Topography—Big Thicket National Preserve: Little Pine Island Bayou Corridor Unit, Texas, 2014

A first-surface topography Digital Elevation Model (DEM) mosaic for the Little Pine Island Bayou Corridor Unit of Big Thicket National Preserve in Texas was produced from remotely sensed, geographically referenced elevation measurements collected on January 15, 21, 22, 26, and 30, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point density of 1.4 points per square meter. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_LowerNechesRiverCorridorUnit_EAARLB_BE_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Lower Neches River Corridor Unit, Texas, 2014

A bare-earth topography Digital Elevation Model (DEM) mosaic for the Lower Neches River Corridor Unit of Big Thicket National Preserve in Texas was produced from remotely sensed, geographically referenced elevation measurements collected on January 11, 15, 17, 18, 19, 21, 23, 25, 27, and 29, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point density of 1.4 points per square meter. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_LowerNechesRiverCorridorUnit_EAARLB_FS_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Lower Neches River Corridor Unit, Texas, 2014

A first-surface topography Digital Surface Model (DSM) mosaic for the Lower Neches River Corridor Unit of Big Thicket National Preserve in Texas was produced from remotely sensed, geographically referenced elevation measurements collected on January 11, 15, 17, 18, 19, 21, 23, 25, 27, and 29, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point density of 1.4 points per square meter. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_MenardCreekCorridorUnit_EAARLB_BE_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Menard Creek Corridor Unit, Texas, 2014

A bare-earth topography Digital Elevation Model (DEM) mosaic for the Menard Corridor Unit of Big Thicket National Preserve in Texas was produced from remotely sensed, geographically referenced elevation measurements collected on January 21 and 22, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point density of 1.4 points per square meter. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_MenardCreekCorridorUnit_EAARLB_FS_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Menard Creek Corridor Unit, Texas, 2014

A first-surface topography Digital Surface Model (DSM) mosaic for the Menard Corridor Unit of Big Thicket National Preserve in Texas was produced from remotely sensed, geographically referenced elevation measurements collected on January 21 and 22, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point density of 1.4 points per square meter. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_NBJGBUnit_EAARLB_BE_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Neches Bottom and Jack Lore Baygall Unit, Texas, 2014

A bare-earth topography Digital Elevation Model (DEM) mosaic for the Neches Bottom and Jack Lore Baygall Unit of Big Thicket National Preserve in Texas, was produced from remotely sensed, geographically referenced elevation measurements collected on January 11, 15, 17, 18, 21, 23, 25, and 29, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_NBJGBUnit_EAARLB_FS_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Neches Bottom and Jack Lore Baygall Unit, Texas, 2014

A first-surface topography Digital Elevation Model (DEM) mosaic for the Neches Bottom and Jack Lore Baygall Unit of Big Thicket National Preserve in Texas, was produced from remotely sensed, geographically referenced elevation measurements collected on January 11, 15, 17, 18, 21, 23, 25, and 29, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_TurkeyCreekUnit_EAARLB_BE_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Turkey Creek Unit, Texas, 2014

A bare-earth topography digital elevation model (DEM) mosaic for the Turkey Creek Unit of Big Thicket National Preserve in Texas, was produced from remotely sensed, geographically referenced elevation measurements collected on January 19, 21, 22, 25, 26, and 29, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_TurkeyCreekUnit_EAARLB_FS_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Turkey Creek Unit, Texas, 2014

A first-surface topography digital elevation model (DEM) mosaic for the Turkey Creek Unit of Big Thicket National Preserve in Texas, was produced from remotely sensed, geographically referenced elevation measurements collected on January 19, 21, 22, 25, 26, and 29, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5-1.6 meters. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_VillageCreekCorridorUnit_EAARLB_BE_z15_n88g12A_mosaic_metadata: EAARL-B Topography-Big Thicket National Preserve: Village Creek Corridor Unit, Texas, 2014

A bare-earth topography Digital Elevation Model (DEM) mosaic for the Village Creek Corridor Unit of Big Thicket National Preserve in Texas was produced from remotely sensed, geographically referenced elevation measurements collected on January 19, 21, 22, 23, 26, 27, and 29, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point density of 1.4 points per square meter. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
BITH2014_VillageCreekCorridorUnit_EAARLB_FS_z15_n88g12A_mosaic_metadata: EAARL-B Topography—Big Thicket National Preserve: Village Creek Corridor Unit, Texas, 2014

A first-surface topography Digital Surface Model (DSM) mosaic for the Village Creek Corridor Unit of Big Thicket National Preserve in Texas was produced from remotely sensed, geographically referenced elevation measurements collected on January 19, 21, 22, 23, 26, 27, and 29, 2014 by the U.S. Geological Survey, in cooperation with the National Park Service - Gulf Coast Network. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point density of 1.4 points per square meter. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
CACO2002_EAARLA_BE_z19_n88g12B_metadata: EAARL Coastal Topography--Cape Cod National Seashore, Massachusetts, 2002: Bare Earth

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements acquired cooperatively by the U.S. Geological Survey (USGS) and the National Park Service (NPS). Elevation measurements were collected over Cape Cod National Seashore using the first-generation National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
CACO2002_EAARLA_BE_z19_n88g12B_mosaic_metadata: EAARL Coastal Topography--Cape Cod National Seashore, Massachusetts, 2002: Bare Earth

A bare-earth topography Digital Elevation Model (DEM) mosaic for the Cape Cod National Seashore was produced from remotely sensed, geographically referenced elevation measurements acquired cooperatively by the U.S. Geological Survey (USGS) and the National Park Service (NPS). Elevation measurements were collected over Cape Cod National Seashore using the first-generation National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
CACO2002_EAARLA_FS_z19_n88g12B_metadata: EAARL Coastal Topography--Cape Cod National Seashore, Massachusetts, 2002: First Surface

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements acquired cooperatively by the U.S. Geological Survey (USGS) and the National Park Service (NPS). Elevation measurements were collected over Cape Cod National Seashore using the first-generation National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
CACO2002_EAARLA_FS_z19_n88g12B_mosaic_metadata: EAARL Coastal Topography--Cape Cod National Seashore, Massachusetts, 2002: First Surface

A first-surface topography Digital Elevation Model (DEM) mosaic for the Cape Cod National Seashore was produced from remotely sensed, geographically referenced elevation measurements acquired cooperatively by the U.S. Geological Survey (USGS) and the National Park Service (NPS). Elevation measurements were collected over Cape Cod National Seashore using the first-generation National Aeronautics and Space Administration (NASA) Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
CRKR2014_EAARLB_z17_n88g12A_metadata: EAARL-B Submerged Topography—Crocker Reef, Florida, 2014

ASCII XYZ point cloud data for a portion of the submerged environs of Crocker Reef, Florida, were produced from remotely sensed, geographically referenced elevation measurements collected on April 13 and 22, 2014 by the U.S. Geological Survey. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point density of 0.9 points per square meter. A peak sampling rate of 15-30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
CRKR2014_EAARLB_z17_n88g12A_mosaic_metadata: EAARL-B Submerged Topography—Crocker Reef, Florida, 2014

A submerged topography digital elevation model (DEM) mosaic for a portion of the submerged environs of Crocker Reef, Florida, was produced from remotely sensed, geographically referenced elevation measurements collected on April 13 and 22, 2014 by the U.S. Geological Survey. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point density of 0.9 points per square meter. A peak sampling rate of 15–30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
ds765_metadata: Coastal Topography--Northeast Atlantic Coast, Post-Hurricane Sandy, 2012

Dune features (dune crest and toe elevations) and mean-high-water shoreline data for a portion of the New York, Delaware, Maryland, Virginia, and North Carolina coastlines, post-Hurricane Sandy (Sandy was an October 2012 hurricane that made landfall as an extratropical cyclone on the 29th), were produced by the U.S. Geological Survey (USGS) from remotely sensed, geographically referenced elevation measurements collected by Photo Science and Woolpert using using airborne lidar sensors. Binary point-cloud data, as well as digital elevation models (DEM), were also produced by Photo Science and Woolpert and are included in this Data Series.

Info
DS888-metadata: EAARL-B Coastal Topography—Fire Island, New York, pre-Hurricane Sandy, 2012: Seamless (Bare Earth and Submerged)

American Standard Code Information Interchange XYZ and binary point-cloud data, as well as a seamless (bare-earth and submerged) digital elevation model for part of Fire Island, New York, pre-Hurricane Sandy (October 2012 hurricane), were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar, a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5–1.6 meters. The nominal vertical elevation accuracy expressed as the root mean square error (RMSE) is 5.24 centimeters for the bare earth topography. Additional data were insufficient to calculate an RMSE for the submerged topography. A peak sampling rate of 15–30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
DS888_PRSF_tile_extents: EAARL-B Coastal Topography—Fire Island, New York, pre-Hurricane Sandy, 2012: Seamless (Bare Earth and Submerged)

This shapefile was produced from 53 2-kilometer by 2-kilometer tile extents of remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar, a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5–1.6 meters. The nominal vertical elevation accuracy expressed as the root mean square error (RMSE) is 5.24 centimeters for the bare earth topography. Additional data were insufficient to calculate an RMSE for the submerged topography. A peak sampling rate of 15–30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EasternLA2008_EAARLA_BE_n88g03_metadata: EAARL Coastal Topography–Eastern Louisiana Barrier Islands, 09 March 2008: Bare Earth

ASCII XYZ point cloud data were produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over some of the eastern Louisiana barrier islands in cooperation with the National Park Service (NPS), using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
EasternLA2008_EAARLA_BE_n88g03_mosaic_metadata: EAARL Coastal Topography–Eastern Louisiana Barrier Islands, 09 March 2008: Bare Earth

A Digital Elevation Model (DEM) mosaic was produced from remotely sensed, geographically referenced elevation measurements by the U.S. Geological Survey (USGS). Elevation measurements were collected over some of the eastern Louisiana barrier islands in cooperation with the National Park Service (NPS), using the Experimental Advanced Airborne Research Lidar (EAARL), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 60 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 2-3 meters. The EAARL, developed originally by NASA at Wallops Flight Facility in Virginia, measures ground elevation with a vertical resolution of 3 centimeters. A sampling rate of 3 kilohertz or higher results in an extremely dense spatial elevation dataset. Over 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
FIIS2002_EAARLA_BE_z18_n88g99_metadata: Lidar-Derived Bare-Earth XYZ for EAARL Coastal Topography—Fire Island, New York, 2002

ASCII XYZ data for Fire Island, New York, was produced from remotely sensed, geographically referenced elevation measurements collected October 25 and November 8, 2002 by the U.S. Geological Survey, in cooperation with the National Park Service (NPS) and the National Aeronautics and Space Administration (NASA). Elevation measurements were collected over the area using the first-generation Experimental Advanced Airborne Research Lidar (EAARL-A), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
FIIS2002_EAARLA_BE_z18_n88g99_mosaic_metadata: Lidar-Derived Bare-Earth Digital Elevation Model (DEM) Mosaic for EAARL Coastal Topography—Fire Island, New York, 2002

A digital elevation model (DEM) mosaic for Fire Island, New York, was produced from remotely sensed, geographically referenced elevation measurements collected October 25 and November 8, 2002 by the U.S. Geological Survey, in cooperation with the National Park Service (NPS) and the National Aeronautics and Space Administration (NASA). Elevation measurements were collected over the area using the first-generation Experimental Advanced Airborne Research Lidar (EAARL-A), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
KEYS2016_SM_z17_n88g12B_classified_metadata: Coastal Topography-Upper Florida Keys Reef Tract, Florida, 26-30 June 2016

Binary point-cloud data were produced for a portion of the upper Florida Keys reef tract, Florida, from remotely sensed, geographically referenced elevation measurements collected by Leading Edge Geomatics (LEG) using a Leica Chiroptera II Bathymetric and Topographic Sensor. Dewberry reports that the nominal pulse spacing for this project was 1 point every 0.7 meters. Dewberry used proprietary procedures to classify the LAS according to project specifications: 0-Never Classified, 1-Unclassified, 2-Ground (includes model key point bit for points identified as Model Key Point), 7-Low Noise, 17-Bridges, 18-High Noise, 40-Bathymetric point or submerged topography (includes model key point bit for points identified as Model Key Point), 41-Water Surface, and 42-Derived water surface.

Info
KEYS2016_SM_z17_n88g12B_mosaic_metadata: Coastal Topography-Upper Florida Keys Reef Tract, Florida, 26-30 June 2016

A digital elevation model (DEM) mosaic was produced for a portion of the upper Florida Keys reef tract, Florida, from remotely sensed, geographically referenced elevation measurements collected by Leading Edge Geomatics (LEG) using a Leica Chiroptera II Bathymetric and Topographic Sensor. Dewberry reports that the nominal pulse spacing for this project was 1 point every 0.7 meters. Dewberry used proprietary procedures to classify the LAS according to project specifications: 0-Never Classified, 1-Unclassified, 2-Ground (includes model key point bit for points identified as Model Key Point), 7-Low Noise, 17-Bridges, 18-High Noise, 40-Bathymetric point or submerged topography (includes model key point bit for points identified as Model Key Point), 41-Water Surface, and 42-Derived water surface.

Info
LINY2011_HRIR_BE_z18_n88g09_classified_metadata: Coastal Topography—Long Island, New York, Post-Hurricane Irene, 30 August 2011

Binary point-cloud data were produced for Long Island, New York, from remotely sensed, geographically referenced elevation measurements collected by Woolpert, Inc. using an Leica ALS50-II lidar sensor flown on a Cessna 404 aircraft. These data were collected post-Hurricane Irene on August 30, 2011.

Info
LINY2011_HRIR_BE_z18_n88g09_mosaic_metadata: Coastal Topography—Long Island, New York, Post-Hurricane Irene, 30 August 2011

A digital elevation model (DEM) mosaic was produced for Long Island, New York, from remotely sensed, geographically referenced elevation measurements collected by Woolpert, Inc. using an Leica ALS50-II lidar sensor flown on a Cessna 404 aircraft. These data were collected post-Hurricane Irene on August 30, 2011.

Info
STCR2014_EAARLB_v09g12B_metadata: EAARL-B Submerged Topography–Saint Croix, U.S. Virgin Islands, 2014

ASCII XYZ point cloud data for a portion of the submerged environs of Saint Croix, U.S. Virgin Islands, was produced from remotely sensed, geographically referenced elevation measurements collected on March 11, 19, and 21, 2014 by the U.S. Geological Survey, in collaboration with the National Oceanic and Atmospheric Administration (NOAA) Coral Reef Conservation Program. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5?1.6 meters. The nominal vertical elevation accuracy expressed as the root mean square error (RMSE) is 13.5 centimeters. A peak sampling rate of 15?30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
STCR2014_EAARLB_v09g12B_mosaic_metadata: EAARL-B Submerged Topography–Saint Croix, U.S. Virgin Islands, 2014

A submerged topography Digital Elevation Model (DEM) mosaic for a portion of the submerged environs of Saint Croix, U.S. Virgin Islands, was produced from remotely sensed, geographically referenced elevation measurements collected on March 11, 19, and 21, 2014 by the U.S. Geological Survey, in collaboration with the National Oceanic and Atmospheric Administration (NOAA) Coral Reef Conservation Program. Elevation measurements were collected over the area using the second-generation Experimental Advanced Airborne Research Lidar (EAARL-B), a pulsed laser ranging system mounted onboard an aircraft to measure ground elevation, vegetation canopy, and coastal topography. The system uses high-frequency laser beams directed at the Earth's surface through an opening in the bottom of the aircraft's fuselage. The laser system records the time difference between emission of the laser beam and the reception of the reflected laser signal in the aircraft. The plane travels over the target area at approximately 55 meters per second at an elevation of approximately 300 meters, resulting in a laser swath of approximately 240 meters with an average point spacing of 0.5?1.6 meters. The nominal vertical elevation accuracy expressed as the root mean square error (RMSE) is 13.5 centimeters. A peak sampling rate of 15?30 kilohertz results in an extremely dense spatial elevation dataset. More than 100 kilometers of coastline can be surveyed easily within a 3- to 4-hour mission. When resultant elevation maps for an area are analyzed, they provide a useful tool to make management decisions regarding land development.

Info
Seafloor Elevation and Volume Change along the Upper Florida Keys reef tract: 1934 to 2002 and 2002 to 2016

Coral reefs serve as natural barriers that protect adjacent shorelines from coastal hazards such as storms, waves, and erosion. The U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center (SPCMSC) conducted research to quantify the combined effect of all constructive and destructive processes on modern coral reef ecosystems by measuring regional-scale changes in seafloor elevation. USGS staff conducted research to quantify bathymetric changes in the Northern Florida Keys from Triumph Reef to Pickles Reef during two time periods, 1934 to 2002, and 2002 to 2016, within a 234.2 square-kilometer area. USGS staff calculated changes in seafloor elevation for both time periods using historical hydrographic surveys (H-sheets) collected by the U.S. Coast and Geodetic Survey (USC&GS) in 1934 and 1935, light detection and ranging (lidar)-derived digital elevation models (DEMs) acquired by the USGS in 2001 and 2002, and lidar-derived DEMs acquired by the National Oceanic and Atmospheric Administration (NOAA) in 2016 and 2017. An elevation change analysis for the two time periods was performed to quantify and map impacts to seafloor elevation for the full study site and 3 sub-regions: Upper, Middle, and Lower. Elevation and volume change statistics were also computed for eleven habitat types found within the study area. For more information about the methods used in this study, refer to Yates and others (2017) and Johnson and others (2026).

Info